Transcript: Mouse NM_008109.3

Mus musculus growth differentiation factor 5 (Gdf5), mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Gdf5 (14563)
Length:
2320
CDS:
313..1800

Additional Resources:

NCBI RefSeq record:
NM_008109.3
NBCI Gene record:
Gdf5 (14563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068121 CGCAGTCATTCAGACCCTAAT pLKO.1 1632 CDS 100% 10.800 15.120 N Gdf5 n/a
2 TRCN0000068122 CCTAGTGTTTGGTCGTACCAA pLKO.1 1320 CDS 100% 3.000 4.200 N Gdf5 n/a
3 TRCN0000068120 CGTGTTTGACATCAGTGCCTT pLKO.1 960 CDS 100% 2.640 3.696 N Gdf5 n/a
4 TRCN0000068119 GCCAACAACGTGGTGTATAAA pLKO.1 1738 CDS 100% 15.000 10.500 N Gdf5 n/a
5 TRCN0000412989 AGCTATATCCTAAGCTCTTTA pLKO_005 2110 3UTR 100% 13.200 9.240 N Gdf5 n/a
6 TRCN0000058344 CAACACCATCACCAGCTTTAT pLKO.1 891 CDS 100% 13.200 9.240 N GDF5 n/a
7 TRCN0000068118 GCTCAGGAAAGGTGTTCTTAA pLKO.1 2019 3UTR 100% 13.200 9.240 N Gdf5 n/a
8 TRCN0000414909 TGGATGTGATCTGGACTAAAG pLKO_005 1945 3UTR 100% 10.800 7.560 N Gdf5 n/a
9 TRCN0000058343 GCAGAGGTACGTGTTTGACAT pLKO.1 951 CDS 100% 4.950 3.465 N GDF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07207 pDONR223 100% 89.9% 91.4% None (many diffs) n/a
2 ccsbBroad304_07207 pLX_304 0% 89.9% 91.4% V5 (many diffs) n/a
3 TRCN0000474107 CTGCGGTCCACTTGAGTATAATGT pLX_317 1.5% 89.9% 91.4% V5 (many diffs) n/a
Download CSV