Transcript: Mouse NM_008122.3

Mus musculus gap junction protein, gamma 1 (Gjc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gjc1 (14615)
Length:
2533
CDS:
836..2026

Additional Resources:

NCBI RefSeq record:
NM_008122.3
NBCI Gene record:
Gjc1 (14615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060287 CGAGACTCACTAAACAGTAAA pLKO.1 1610 CDS 100% 13.200 18.480 N GJC1 n/a
2 TRCN0000060285 CGGGTGCTTATAATTATCCTT pLKO.1 1650 CDS 100% 3.000 4.200 N GJC1 n/a
3 TRCN0000068642 CCTCTGCCTATTGCTTAACAT pLKO.1 1555 CDS 100% 5.625 4.500 N Gjc1 n/a
4 TRCN0000317859 CCTCTGCCTATTGCTTAACAT pLKO_005 1555 CDS 100% 5.625 4.500 N Gjc1 n/a
5 TRCN0000319672 TCCAGAGAAGAACTGATATAT pLKO_005 2271 3UTR 100% 15.000 10.500 N Gjc1 n/a
6 TRCN0000319610 ATCCACAACCATTCGACATTT pLKO_005 872 CDS 100% 13.200 9.240 N Gjc1 n/a
7 TRCN0000068641 CCTGGGATATGCTATTCATAA pLKO.1 1108 CDS 100% 13.200 9.240 N Gjc1 n/a
8 TRCN0000068638 GCTTTCTAATAGGGCAGTATT pLKO.1 1404 CDS 100% 13.200 9.240 N Gjc1 n/a
9 TRCN0000319671 TTGATGATCCGGGTGCTTATA pLKO_005 1641 CDS 100% 13.200 9.240 N Gjc1 n/a
10 TRCN0000319673 ATGTACCTGGGATATGCTATT pLKO_005 1103 CDS 100% 10.800 7.560 N Gjc1 n/a
11 TRCN0000068639 CCATCTACTATGATGAACAAA pLKO.1 960 CDS 100% 5.625 3.938 N Gjc1 n/a
12 TRCN0000068640 CCTCATAAGATAGACTGCTTT pLKO.1 1478 CDS 100% 4.950 3.465 N Gjc1 n/a
13 TRCN0000428105 AGACCTCCGTCTGGATTTAAT pLKO_005 2007 CDS 100% 15.000 9.000 N GJC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07538 pDONR223 100% 92.2% 96.9% None (many diffs) n/a
2 ccsbBroad304_07538 pLX_304 0% 92.2% 96.9% V5 (many diffs) n/a
Download CSV