Transcript: Mouse NM_008150.2

Mus musculus glypican 4 (Gpc4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gpc4 (14735)
Length:
2325
CDS:
149..1822

Additional Resources:

NCBI RefSeq record:
NM_008150.2
NBCI Gene record:
Gpc4 (14735)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008150.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109469 CTTCGGGTTATGACCAGTAAA pLKO.1 1550 CDS 100% 13.200 10.560 N Gpc4 n/a
2 TRCN0000304811 CGCTACTATGTGGCGGGAAAT pLKO_005 590 CDS 100% 10.800 8.640 N Gpc4 n/a
3 TRCN0000109466 GCATCCCGTTACAAGAAGTTT pLKO.1 443 CDS 100% 5.625 4.500 N Gpc4 n/a
4 TRCN0000316584 GCATCCCGTTACAAGAAGTTT pLKO_005 443 CDS 100% 5.625 4.500 N Gpc4 n/a
5 TRCN0000374486 AGTTGCAAGGGATGTAGTAAG pLKO_005 826 CDS 100% 10.800 7.560 N Gpc4 n/a
6 TRCN0000109468 GCAGAGAAATCCCTGAATGAT pLKO.1 494 CDS 100% 5.625 3.938 N Gpc4 n/a
7 TRCN0000316585 GCAGAGAAATCCCTGAATGAT pLKO_005 494 CDS 100% 5.625 3.938 N Gpc4 n/a
8 TRCN0000147567 GCCTGCAAAGTAAAGATGATT pLKO.1 375 CDS 100% 5.625 3.938 N GPC4 n/a
9 TRCN0000109467 CCTTTCAACATTGAGTCCGTT pLKO.1 1061 CDS 100% 2.640 1.848 N Gpc4 n/a
10 TRCN0000109465 GCCACTGGTTTAAGCAATGTT pLKO.1 1958 3UTR 100% 5.625 3.375 N Gpc4 n/a
11 TRCN0000316583 GCCACTGGTTTAAGCAATGTT pLKO_005 1958 3UTR 100% 5.625 3.375 N Gpc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008150.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00553 pDONR223 100% 90.7% 94.4% None (many diffs) n/a
2 ccsbBroad304_00553 pLX_304 0% 90.7% 94.4% V5 (many diffs) n/a
3 TRCN0000475541 ACCCATCTACACCTGCGGGTAAAG pLX_317 17.4% 90.7% 94.4% V5 (many diffs) n/a
Download CSV