Transcript: Mouse NM_008160.6

Mus musculus glutathione peroxidase 1 (Gpx1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Gpx1 (14775)
Length:
1066
CDS:
234..839

Additional Resources:

NCBI RefSeq record:
NM_008160.6
NBCI Gene record:
Gpx1 (14775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008160.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348487 CTGGCATTGGCTTGGTGATTA pLKO_005 847 3UTR 100% 13.200 9.240 N Gpx1 n/a
2 TRCN0000076518 GCACGGAGAAACACCTGATTT pLKO.1 920 3UTR 100% 13.200 9.240 N Gpx1 n/a
3 TRCN0000076522 ACACCAGGAGAATGGCAAGAA pLKO.1 473 CDS 100% 4.950 3.465 N Gpx1 n/a
4 TRCN0000335084 ACACCAGGAGAATGGCAAGAA pLKO_005 473 CDS 100% 4.950 3.465 N Gpx1 n/a
5 TRCN0000222620 GTTTGAGAAGTGCGAAGTGAA pLKO.1 560 CDS 100% 4.950 3.465 N Gpx1 n/a
6 TRCN0000335160 GTTTGAGAAGTGCGAAGTGAA pLKO_005 560 CDS 100% 4.950 3.465 N Gpx1 n/a
7 TRCN0000076519 CCCAAGTACATCATTTGGTCT pLKO.1 666 CDS 100% 2.640 1.848 N Gpx1 n/a
8 TRCN0000076520 CCGGGACTACACCGAGATGAA pLKO.1 386 CDS 100% 1.650 1.155 N Gpx1 n/a
9 TRCN0000335083 CCGGGACTACACCGAGATGAA pLKO_005 386 CDS 100% 1.650 1.155 N Gpx1 n/a
10 TRCN0000046232 CCTGGAACTTTGAGAAGTTCC pLKO.1 709 CDS 100% 0.405 0.203 Y GPX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008160.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00685 pDONR223 100% 82.7% 85.4% None (many diffs) n/a
2 ccsbBroad304_00685 pLX_304 0% 82.7% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470514 CTACAGGTGGGGCTCTCTCCAGTT pLX_317 75.6% 82.7% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV