Transcript: Mouse NM_008224.4

Mus musculus host cell factor C1 (Hcfc1), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hcfc1 (15161)
Length:
8138
CDS:
355..6492

Additional Resources:

NCBI RefSeq record:
NM_008224.4
NBCI Gene record:
Hcfc1 (15161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008224.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235785 CATTCCTATGTCGGCCATTAT pLKO_005 2667 CDS 100% 13.200 18.480 N Hcfc1 n/a
2 TRCN0000235786 CCAACGCCCACATTGACTATA pLKO_005 6284 CDS 100% 13.200 18.480 N Hcfc1 n/a
3 TRCN0000235787 CTGGCACAACTACCATTATTA pLKO_005 2642 CDS 100% 15.000 10.500 N Hcfc1 n/a
4 TRCN0000086291 CCATCAATACTCGTCTGTATA pLKO.1 1340 CDS 100% 13.200 9.240 N Hcfc1 n/a
5 TRCN0000235788 GGAGATAACACCCATACTTAA pLKO_005 6820 3UTR 100% 13.200 9.240 N Hcfc1 n/a
6 TRCN0000235784 TGGCTATCAAGGAGCTTATAG pLKO_005 470 CDS 100% 13.200 9.240 N Hcfc1 n/a
7 TRCN0000086289 CCCAGACTATAACCAGCTAAA pLKO.1 5919 CDS 100% 10.800 7.560 N Hcfc1 n/a
8 TRCN0000086292 CCCTATCATCACAGTACACAA pLKO.1 2244 CDS 100% 4.950 3.465 N Hcfc1 n/a
9 TRCN0000086290 GCCATCAATACTCGTCTGTAT pLKO.1 1339 CDS 100% 4.950 3.465 N Hcfc1 n/a
10 TRCN0000086288 GCCTTTGAGTTCCCACTCAAT pLKO.1 7085 3UTR 100% 0.495 0.347 N Hcfc1 n/a
11 TRCN0000274019 GTAATGGTGACACACTATTTC pLKO_005 5851 CDS 100% 13.200 9.240 N HCFC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008224.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10870 pDONR223 100% 18.8% 20.8% None (many diffs) n/a
2 ccsbBroad304_10870 pLX_304 0% 18.8% 20.8% V5 (many diffs) n/a
3 TRCN0000478554 CCCATGGCGTGAGTCTAGATGATT pLX_317 24.7% 18.8% 20.8% V5 (many diffs) n/a
Download CSV