Transcript: Mouse NM_008225.2

Mus musculus hematopoietic cell specific Lyn substrate 1 (Hcls1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Hcls1 (15163)
Length:
2031
CDS:
93..1553

Additional Resources:

NCBI RefSeq record:
NM_008225.2
NBCI Gene record:
Hcls1 (15163)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233311 TGCTATAGCCCTGTATGATTA pLKO_005 1391 CDS 100% 13.200 18.480 N Hcls1 n/a
2 TRCN0000103626 CCACGGCGTATAAGAAGACAA pLKO.1 748 CDS 100% 4.950 6.930 N Hcls1 n/a
3 TRCN0000103627 GAGAAGGATAAACGGGACAAA pLKO.1 582 CDS 100% 4.950 3.960 N Hcls1 n/a
4 TRCN0000233310 AGGGCTTTGGTGGCCAATATG pLKO_005 667 CDS 100% 13.200 9.240 N Hcls1 n/a
5 TRCN0000103625 CCCGCCTCTTTAAGAGCTTTA pLKO.1 1681 3UTR 100% 10.800 7.560 N Hcls1 n/a
6 TRCN0000233312 CCCGCCTCTTTAAGAGCTTTA pLKO_005 1681 3UTR 100% 10.800 7.560 N Hcls1 n/a
7 TRCN0000257359 GAGCGAAAGGCTGTGGTAAAG pLKO_005 891 CDS 100% 10.800 7.560 N Hcls1 n/a
8 TRCN0000103628 CCCTGACTTTGTGAATGACAT pLKO.1 164 CDS 100% 4.950 3.465 N Hcls1 n/a
9 TRCN0000103629 GCCCTGTATGATTACCAAGGA pLKO.1 1398 CDS 100% 2.640 1.848 N Hcls1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06355 pDONR223 100% 83.5% 83.7% None (many diffs) n/a
2 ccsbBroad304_06355 pLX_304 0% 83.5% 83.7% V5 (many diffs) n/a
3 TRCN0000474708 CGATCAAGAACGGCAATCTTGAAC pLX_317 36.7% 83.5% 83.7% V5 (many diffs) n/a
Download CSV