Transcript: Mouse NM_008250.2

Mus musculus H2.0-like homeobox (Hlx), mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Mus musculus (mouse)
Gene:
Hlx (15284)
Length:
2171
CDS:
353..1783

Additional Resources:

NCBI RefSeq record:
NM_008250.2
NBCI Gene record:
Hlx (15284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070704 GAAATTCTGTTCAGCATCAAT pLKO.1 1077 CDS 100% 5.625 4.500 N Hlx n/a
2 TRCN0000333980 GAAATTCTGTTCAGCATCAAT pLKO_005 1077 CDS 100% 5.625 4.500 N Hlx n/a
3 TRCN0000014820 CCTCCAGCAAAGACCTCAAAT pLKO.1 849 CDS 100% 13.200 9.240 N HLX n/a
4 TRCN0000348063 CTGGACTTTGTGCCTACTTTA pLKO_005 1824 3UTR 100% 13.200 9.240 N Hlx n/a
5 TRCN0000348064 ATGAAGTGGCGGCACTCTAAG pLKO_005 1328 CDS 100% 10.800 7.560 N Hlx n/a
6 TRCN0000347986 CCCTATGCTGTGCTCACTAAG pLKO_005 1118 CDS 100% 10.800 7.560 N Hlx n/a
7 TRCN0000347985 TCGCATCTCTAGATCCCATTA pLKO_005 1014 CDS 100% 10.800 7.560 N Hlx n/a
8 TRCN0000070706 CCCTCCAGCAAAGACCTCAAA pLKO.1 848 CDS 100% 4.950 3.465 N Hlx n/a
9 TRCN0000070703 GCATCAAACCACGGTCATCAA pLKO.1 1543 CDS 100% 4.950 3.465 N Hlx n/a
10 TRCN0000070705 GTCTGCGGAATTTGACCCAAA pLKO.1 889 CDS 100% 4.050 2.835 N Hlx n/a
11 TRCN0000070707 CTGTCAAGAAACCCTCTTTCT pLKO.1 465 CDS 100% 0.495 0.347 N Hlx n/a
12 TRCN0000014821 CGCATCTCTAGATCCCATTAA pLKO.1 1015 CDS 100% 13.200 9.240 N HLX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00749 pDONR223 100% 83.2% 86.6% None (many diffs) n/a
2 ccsbBroad304_00749 pLX_304 0% 83.2% 86.6% V5 (many diffs) n/a
3 TRCN0000468515 AGTTTGGAGAATACTCCATGGCAC pLX_317 22.5% 83.2% 86.6% V5 (many diffs) n/a
Download CSV