Transcript: Mouse NM_008277.3

Mus musculus 4-hydroxyphenylpyruvic acid dioxygenase (Hpd), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Hpd (15445)
Length:
1400
CDS:
48..1229

Additional Resources:

NCBI RefSeq record:
NM_008277.3
NBCI Gene record:
Hpd (15445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008277.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076348 GTCATCTCCAACTGGCTGAAA pLKO.1 1273 3UTR 100% 4.950 3.960 N Hpd n/a
2 TRCN0000076349 CCAGGAATATGTGGACTATAA pLKO.1 803 CDS 100% 13.200 9.240 N Hpd n/a
3 TRCN0000076351 TCCAGGAATATGTGGACTATA pLKO.1 802 CDS 100% 13.200 9.240 N Hpd n/a
4 TRCN0000076352 GCTCTCAATCCCTGGAACAAA pLKO.1 267 CDS 100% 5.625 3.938 N Hpd n/a
5 TRCN0000076350 GCCTCAGAATGGTACCTGAAA pLKO.1 633 CDS 100% 0.000 0.000 N Hpd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008277.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00781 pDONR223 100% 86% 89.8% None (many diffs) n/a
2 ccsbBroad304_00781 pLX_304 0% 86% 89.8% V5 (many diffs) n/a
3 TRCN0000472809 CTTCGACAGGAACCACACGTTATT pLX_317 33.5% 86% 89.8% V5 (many diffs) n/a
Download CSV