Transcript: Mouse NM_008342.3

Mus musculus insulin-like growth factor binding protein 2 (Igfbp2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Igfbp2 (16008)
Length:
1342
CDS:
101..1018

Additional Resources:

NCBI RefSeq record:
NM_008342.3
NBCI Gene record:
Igfbp2 (16008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008342.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420942 TGTTCCGGGAGAAGGTCAATG pLKO_005 612 CDS 100% 10.800 7.560 N Igfbp2 n/a
2 TRCN0000422736 AGACCAACACTGAGCTCAGAA pLKO_005 1136 3UTR 100% 4.950 3.465 N Igfbp2 n/a
3 TRCN0000012860 CGAGTGCCATCTCTTCTACAA pLKO.1 952 CDS 100% 4.950 3.465 N Igfbp2 n/a
4 TRCN0000012858 GAACCTCCCTTGCTTCTGTTA pLKO.1 1192 3UTR 100% 4.950 3.465 N Igfbp2 n/a
5 TRCN0000431455 ACAGTGATGACGACCACTCTG pLKO_005 486 CDS 100% 4.050 2.835 N Igfbp2 n/a
6 TRCN0000012862 CCATGCCCAAAGTGTGCAGTA pLKO.1 997 CDS 100% 4.050 2.835 N Igfbp2 n/a
7 TRCN0000412259 ATGTTGGGAGGTGGTAGCAGT pLKO_005 548 CDS 100% 2.640 1.848 N Igfbp2 n/a
8 TRCN0000012861 CCACGTGGATGGGACCATGAA pLKO.1 526 CDS 100% 1.650 1.155 N Igfbp2 n/a
9 TRCN0000012859 GCAGTGCAAGATGTCTCTGAA pLKO.1 850 CDS 100% 4.950 2.970 N Igfbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008342.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488558 ATTCACAATAGGCGGCACCCTTGT pLX_317 33% 81.4% 82% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV