Transcript: Mouse NM_008418.2

Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 3 (Kcna3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kcna3 (16491)
Length:
1968
CDS:
262..1848

Additional Resources:

NCBI RefSeq record:
NM_008418.2
NBCI Gene record:
Kcna3 (16491)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069192 AGGTGTCTTGACCATTGCATT pLKO.1 1521 CDS 100% 4.950 6.930 N Kcna3 n/a
2 TRCN0000069188 TCTGAGTAAGTCGGAGTATAT pLKO.1 1689 CDS 100% 13.200 10.560 N Kcna3 n/a
3 TRCN0000069191 CGACGCCATCCTCTACTACTA pLKO.1 588 CDS 100% 4.950 3.465 N Kcna3 n/a
4 TRCN0000069189 GCATTGCCAGTTCCTGTGATT pLKO.1 1537 CDS 100% 4.950 3.465 N Kcna3 n/a
5 TRCN0000069190 GCTGGCTGAACGACAAGGTAA pLKO.1 1158 CDS 100% 4.950 3.465 N Kcna3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14683 pDONR223 98.6% 89.9% 96.5% None (many diffs) n/a
2 ccsbBroad304_14683 pLX_304 0% 89.9% 96.5% V5 (many diffs) n/a
3 TRCN0000472900 GAACGCGAACACTTGGCGACCTGG pLX_317 30.8% 89.9% 96.5% V5 (many diffs) n/a
Download CSV