Transcript: Mouse NM_008426.2

Mus musculus potassium inwardly-rectifying channel, subfamily J, member 3 (Kcnj3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kcnj3 (16519)
Length:
5232
CDS:
962..2467

Additional Resources:

NCBI RefSeq record:
NM_008426.2
NBCI Gene record:
Kcnj3 (16519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069736 GCGTTGGAACCTCTTTATCTT pLKO.1 1201 CDS 100% 5.625 7.875 N Kcnj3 n/a
2 TRCN0000069733 CCCATGAAACTCCAACGAATA pLKO.1 2261 CDS 100% 10.800 7.560 N Kcnj3 n/a
3 TRCN0000069735 CCTACCAGGATGGAAGGAAAT pLKO.1 2402 CDS 100% 10.800 7.560 N Kcnj3 n/a
4 TRCN0000069734 GCAGGAGGAAATGCTTCTCAT pLKO.1 2041 CDS 100% 4.950 3.465 N Kcnj3 n/a
5 TRCN0000069737 CCCTTTAATAGCACCAGCCAT pLKO.1 2068 CDS 100% 2.640 1.848 N Kcnj3 n/a
6 TRCN0000044330 CCAATGTCTATAACTTCCCTT pLKO.1 1335 CDS 100% 2.640 2.112 N KCNJ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06476 pDONR223 100% 93% 98.6% None (many diffs) n/a
2 ccsbBroad304_06476 pLX_304 0% 93% 98.6% V5 (many diffs) n/a
3 TRCN0000468883 TTGTGATAATGCCGACTGATAATT pLX_317 29.6% 93% 98.6% V5 (many diffs) n/a
Download CSV