Transcript: Mouse NM_008430.2

Mus musculus potassium channel, subfamily K, member 1 (Kcnk1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kcnk1 (16525)
Length:
2306
CDS:
359..1369

Additional Resources:

NCBI RefSeq record:
NM_008430.2
NBCI Gene record:
Kcnk1 (16525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069898 GCCTAACAAACTCAAGAGAAA pLKO.1 1998 3UTR 100% 4.950 3.960 N Kcnk1 n/a
2 TRCN0000069901 CAAAGCCTTCTGCATCATCTA pLKO.1 748 CDS 100% 4.950 3.465 N Kcnk1 n/a
3 TRCN0000069902 TGTCACCGTTTCCTGCTTCTT pLKO.1 925 CDS 100% 4.950 3.465 N Kcnk1 n/a
4 TRCN0000069899 GCAGAAGCAAAGTGAGCCTTT pLKO.1 1300 CDS 100% 4.050 2.835 N Kcnk1 n/a
5 TRCN0000069900 GCTGAAGAAGTTCAGGAAGAT pLKO.1 1174 CDS 100% 0.495 0.297 N Kcnk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06483 pDONR223 100% 88.7% 94.9% None (many diffs) n/a
2 ccsbBroad304_06483 pLX_304 0% 88.7% 94.9% V5 (many diffs) n/a
3 TRCN0000473228 ATCAGGACTCTTCCTTCGAACTCC pLX_317 37% 88.7% 94.9% V5 (many diffs) n/a
Download CSV