Transcript: Mouse NM_008445.2

Mus musculus kinesin family member 3C (Kif3c), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kif3c (16570)
Length:
6849
CDS:
850..3240

Additional Resources:

NCBI RefSeq record:
NM_008445.2
NBCI Gene record:
Kif3c (16570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089809 CGTCCACAACTAAAGTGCGAA pLKO.1 3110 CDS 100% 2.640 3.696 N Kif3c n/a
2 TRCN0000089810 GCCAAATGAAGAAGCGTCCAA pLKO.1 2870 CDS 100% 2.640 3.696 N Kif3c n/a
3 TRCN0000323645 GCCAAATGAAGAAGCGTCCAA pLKO_005 2870 CDS 100% 2.640 3.696 N Kif3c n/a
4 TRCN0000305593 GAAACGCCGTGAACGGGAAAT pLKO_005 2502 CDS 100% 10.800 8.640 N Kif3c n/a
5 TRCN0000311368 GGTTTCAACGGCACCGTATTT pLKO_005 1111 CDS 100% 13.200 9.240 N Kif3c n/a
6 TRCN0000089811 TGGAGTGAATAACAGCCAAAT pLKO.1 2856 CDS 100% 10.800 7.560 N Kif3c n/a
7 TRCN0000323644 TGGAGTGAATAACAGCCAAAT pLKO_005 2856 CDS 100% 10.800 7.560 N Kif3c n/a
8 TRCN0000089812 CTCTTCCTTTGTCACCAAGAA pLKO.1 1389 CDS 100% 4.950 3.465 N Kif3c n/a
9 TRCN0000089808 GCTTGGTTAGTGAGAAGAGAT pLKO.1 3440 3UTR 100% 4.950 3.465 N Kif3c n/a
10 TRCN0000323643 GCTTGGTTAGTGAGAAGAGAT pLKO_005 3440 3UTR 100% 4.950 3.465 N Kif3c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478040 CTAGGGCAGCGCGCTAGCTTAGAC pLX_317 19.5% 89.2% 95.1% V5 (many diffs) n/a
2 ccsbBroadEn_10435 pDONR223 100% 89.1% 94.9% None (many diffs) n/a
3 ccsbBroad304_10435 pLX_304 0% 89.1% 94.9% V5 (many diffs) n/a
4 TRCN0000491480 GAATACGCGCGTGTCACATCCGTC pLX_317 13.3% 84.6% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489943 TGACGAGCTTCAAAACAAGCCACG pLX_317 18.8% 84.6% 90.2% V5 (many diffs) n/a
Download CSV