Transcript: Mouse NM_008512.2

Mus musculus low density lipoprotein receptor-related protein 1 (Lrp1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Lrp1 (16971)
Length:
14907
CDS:
462..14099

Additional Resources:

NCBI RefSeq record:
NM_008512.2
NBCI Gene record:
Lrp1 (16971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119623 GCGAACAAATACACTGGCTAA pLKO.1 4952 CDS 100% 4.050 5.670 N Lrp1 n/a
2 TRCN0000119622 GCTGAACACATTCTTTGGTAA pLKO.1 14674 3UTR 100% 4.950 3.960 N Lrp1 n/a
3 TRCN0000323667 GCTGAACACATTCTTTGGTAA pLKO_005 14674 3UTR 100% 4.950 3.960 N Lrp1 n/a
4 TRCN0000119625 CGCTTGTGTATTCCCAAGCAT pLKO.1 8946 CDS 100% 0.300 0.240 N Lrp1 n/a
5 TRCN0000349032 AGGCGCCTGTGTGGTCAATAA pLKO_005 13511 CDS 100% 13.200 9.240 N Lrp1 n/a
6 TRCN0000305553 CGACAACGACTGCGGAGATAA pLKO_005 11135 CDS 100% 13.200 9.240 N Lrp1 n/a
7 TRCN0000119624 CGGAGTCACTTACATCAATAA pLKO.1 12773 CDS 100% 13.200 9.240 N Lrp1 n/a
8 TRCN0000323679 CGGAGTCACTTACATCAATAA pLKO_005 12773 CDS 100% 13.200 9.240 N Lrp1 n/a
9 TRCN0000119626 CCTACCTACAAGATGTATGAA pLKO.1 13875 CDS 100% 5.625 3.938 N Lrp1 n/a
10 TRCN0000323599 CCTACCTACAAGATGTATGAA pLKO_005 13875 CDS 100% 5.625 3.938 N Lrp1 n/a
11 TRCN0000053256 CCTGCAACAATGGCAGATGTA pLKO.1 3412 CDS 100% 4.950 3.465 N LRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10952 pDONR223 100% 5.6% 5.8% None (many diffs) n/a
2 ccsbBroad304_10952 pLX_304 0% 5.6% 5.8% V5 (many diffs) n/a
3 TRCN0000472269 CTTTCGCACCTTGTACGGACCGCT pLX_317 38.9% 5.6% 5.8% V5 (many diffs) n/a
Download CSV