Transcript: Mouse NM_008540.3

Mus musculus SMAD family member 4 (Smad4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Mus musculus (mouse)
Gene:
Smad4 (17128)
Length:
7614
CDS:
491..2146

Additional Resources:

NCBI RefSeq record:
NM_008540.3
NBCI Gene record:
Smad4 (17128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345664 ATCTACCCAAGCGCGTATATA pLKO_005 1772 CDS 100% 15.000 21.000 N Smad4 n/a
2 TRCN0000362660 ATCCAACACCCGCCAAGTAAT pLKO_005 1031 CDS 100% 13.200 18.480 N Smad4 n/a
3 TRCN0000362661 ATGAGTACGTTCACGACTTTG pLKO_005 966 CDS 100% 10.800 15.120 N Smad4 n/a
4 TRCN0000025953 CCATATCACTATGAGCGGGTT pLKO.1 878 CDS 100% 2.160 3.024 N Smad4 n/a
5 TRCN0000345740 TGCACCATACACACCTAATTT pLKO_005 1306 CDS 100% 15.000 12.000 N Smad4 n/a
6 TRCN0000025900 GCCAGCTACTTACCATCATAA pLKO.1 1255 CDS 100% 13.200 9.240 N Smad4 n/a
7 TRCN0000345739 TCAGGTAGGAGAGACGTTTAA pLKO_005 1486 CDS 100% 13.200 9.240 N Smad4 n/a
8 TRCN0000025881 GCTTACTTTGAAATGGACGTT pLKO.1 1466 CDS 100% 2.640 1.848 N Smad4 n/a
9 TRCN0000025885 GCGATTGTGCATTCTCAGGAT pLKO.1 1975 CDS 100% 2.640 1.584 N Smad4 n/a
10 TRCN0000345738 GCGATTGTGCATTCTCAGGAT pLKO_005 1975 CDS 100% 2.640 1.584 N Smad4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00962 pDONR223 100% 91.5% 98.3% None (many diffs) n/a
2 ccsbBroad304_00962 pLX_304 36.6% 91.5% 98.3% V5 (many diffs) n/a
3 TRCN0000469053 TCGTCACACAGCCCGGTGTTGGGA pLX_317 18.6% 91.5% 98.3% V5 (many diffs) n/a
Download CSV