Transcript: Mouse NM_008583.2

Mus musculus multiple endocrine neoplasia 1 (Men1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Men1 (17283)
Length:
2980
CDS:
423..2258

Additional Resources:

NCBI RefSeq record:
NM_008583.2
NBCI Gene record:
Men1 (17283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310893 TACATATTGCTGCCCGAATTT pLKO_005 2698 3UTR 100% 13.200 18.480 N Men1 n/a
2 TRCN0000304368 TACCACTGTCGCAACCGAAAT pLKO_005 1401 CDS 100% 0.000 0.000 N Men1 n/a
3 TRCN0000304369 TGGCCGACCTATCCATCATTG pLKO_005 661 CDS 100% 10.800 7.560 N Men1 n/a
4 TRCN0000310895 TTTGCCCACCTGCTGCGATTT pLKO_005 1650 CDS 100% 10.800 7.560 N Men1 n/a
5 TRCN0000034396 CAGCGACTACACACTCTCTTT pLKO.1 2210 CDS 100% 4.950 3.465 N Men1 n/a
6 TRCN0000034397 CGATCTTCACACTGACTCTTT pLKO.1 1163 CDS 100% 4.950 3.465 N Men1 n/a
7 TRCN0000301599 CGATCTTCACACTGACTCTTT pLKO_005 1163 CDS 100% 4.950 3.465 N Men1 n/a
8 TRCN0000034394 GCTCCGACTCTTATCTGTGAA pLKO.1 2763 3UTR 100% 4.950 3.465 N Men1 n/a
9 TRCN0000034395 CCCTGTCTGAAGATCATGCTT pLKO.1 949 CDS 100% 3.000 2.100 N Men1 n/a
10 TRCN0000034398 CACCCTTTATCACAAGGGAAT pLKO.1 1319 CDS 100% 0.405 0.284 N Men1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10964 pDONR223 100% 83.5% 90.8% None (many diffs) n/a
2 ccsbBroad304_10964 pLX_304 0% 83.5% 90.8% V5 (many diffs) n/a
3 TRCN0000471053 CCTGGATTATATCCTACGGAACCA pLX_317 21.8% 83.5% 90.8% V5 (many diffs) n/a
Download CSV