Transcript: Mouse NM_008617.2

Mus musculus malate dehydrogenase 2, NAD (mitochondrial) (Mdh2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mdh2 (17448)
Length:
1297
CDS:
88..1104

Additional Resources:

NCBI RefSeq record:
NM_008617.2
NBCI Gene record:
Mdh2 (17448)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041792 CGGTGTGTACAACCCTAACAA pLKO.1 561 CDS 100% 5.625 7.875 N Mdh2 n/a
2 TRCN0000308643 CGGTGTGTACAACCCTAACAA pLKO_005 561 CDS 100% 5.625 7.875 N Mdh2 n/a
3 TRCN0000041790 CGGAATGCACTTACTTCTCTA pLKO.1 935 CDS 100% 4.950 3.960 N Mdh2 n/a
4 TRCN0000308702 CGGAATGCACTTACTTCTCTA pLKO_005 935 CDS 100% 4.950 3.960 N Mdh2 n/a
5 TRCN0000041791 GCAAATGTGAAAGGCTACCTT pLKO.1 310 CDS 100% 3.000 2.100 N Mdh2 n/a
6 TRCN0000041789 GCAGAGCTAAAGGGTTTGGAT pLKO.1 631 CDS 100% 3.000 2.100 N Mdh2 n/a
7 TRCN0000308642 GCAGAGCTAAAGGGTTTGGAT pLKO_005 631 CDS 100% 3.000 2.100 N Mdh2 n/a
8 TRCN0000041788 GCATCCTAACTTATTCAGCAT pLKO.1 1136 3UTR 100% 2.640 1.848 N Mdh2 n/a
9 TRCN0000308703 GCATCCTAACTTATTCAGCAT pLKO_005 1136 3UTR 100% 2.640 1.848 N Mdh2 n/a
10 TRCN0000221881 GCCCAGAACAATGCTAAAGTA pLKO.1 148 CDS 100% 5.625 3.938 N MDH2 n/a
11 TRCN0000278345 GCCCAGAACAATGCTAAAGTA pLKO_005 148 CDS 100% 5.625 3.938 N MDH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06574 pDONR223 100% 85.2% 94.6% None (many diffs) n/a
2 ccsbBroad304_06574 pLX_304 0% 85.2% 94.6% V5 (many diffs) n/a
3 TRCN0000492023 CGCAAGAGCACAAGGGTCTTCCGC pLX_317 38.2% 85.2% 94.6% V5 (many diffs) n/a
Download CSV