Transcript: Mouse NM_008691.2

Mus musculus neurofilament, medium polypeptide (Nefm), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nefm (18040)
Length:
3244
CDS:
192..2738

Additional Resources:

NCBI RefSeq record:
NM_008691.2
NBCI Gene record:
Nefm (18040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438884 CACGGTAGAGCGCAAAGATTA pLKO_005 947 CDS 100% 13.200 18.480 N Nefm n/a
2 TRCN0000089730 CGAAGAGTCGTCGATGGTTAA pLKO.1 815 CDS 100% 10.800 15.120 N Nefm n/a
3 TRCN0000089729 CGATGGTGCTACCAAATACAT pLKO.1 2585 CDS 100% 5.625 7.875 N Nefm n/a
4 TRCN0000422455 AGCCTTAAGAAAGCTATATAT pLKO_005 3061 3UTR 100% 15.000 10.500 N Nefm n/a
5 TRCN0000438389 GGCTCGTCATTTGCGAGAATA pLKO_005 1316 CDS 100% 13.200 9.240 N Nefm n/a
6 TRCN0000089731 GTCACAATATCCAGTAAGATT pLKO.1 1476 CDS 100% 5.625 3.938 N Nefm n/a
7 TRCN0000089728 CCGTGGAAGAAGTAAAGCCAA pLKO.1 2023 CDS 100% 2.640 1.848 N Nefm n/a
8 TRCN0000089732 AGAGTGGTTCAAATGCCGCTA pLKO.1 1052 CDS 100% 2.160 1.512 N Nefm n/a
9 TRCN0000136053 GAAGAAGAGGAGGAAGATGAA pLKO.1 1770 CDS 100% 4.950 2.475 Y GRWD1 n/a
10 TRCN0000116396 GTGCTACCAAATACATCACTA pLKO.1 2590 CDS 100% 4.950 3.465 N NEFM n/a
11 TRCN0000289719 GTGCTACCAAATACATCACTA pLKO_005 2590 CDS 100% 4.950 3.465 N NEFM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06630 pDONR223 100% 81.2% 83% None (many diffs) n/a
2 ccsbBroad304_06630 pLX_304 0% 81.2% 83% V5 (many diffs) n/a
3 TRCN0000481510 GTCCAGATGAACATCACGTCCCCT pLX_317 17.6% 81.2% 83% V5 (many diffs) n/a
Download CSV