Transcript: Mouse NM_008751.5

Mus musculus neurexophilin 1 (Nxph1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Nxph1 (18231)
Length:
1783
CDS:
236..1051

Additional Resources:

NCBI RefSeq record:
NM_008751.5
NBCI Gene record:
Nxph1 (18231)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008751.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106549 GAGCAGCAAATCCACGCTAAA pLKO.1 343 CDS 100% 10.800 7.560 N Nxph1 n/a
2 TRCN0000106548 ACCGTGATTGATGCTAAAGAT pLKO.1 779 CDS 100% 5.625 3.938 N Nxph1 n/a
3 TRCN0000106547 CCACTGGTCAAGGGAATGTAT pLKO.1 705 CDS 100% 5.625 3.938 N Nxph1 n/a
4 TRCN0000106546 CCGTGATTGATGCTAAAGATT pLKO.1 780 CDS 100% 5.625 3.938 N Nxph1 n/a
5 TRCN0000161250 GCACAACAAACCGTGATTGAT pLKO.1 770 CDS 100% 5.625 3.938 N NXPH1 n/a
6 TRCN0000158978 GCTTTCATTGTCTGACTCATA pLKO.1 1360 3UTR 100% 4.950 3.465 N NXPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008751.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03130 pDONR223 100% 92.7% 99.6% None (many diffs) n/a
2 ccsbBroad304_03130 pLX_304 0% 92.7% 99.6% V5 (many diffs) n/a
3 TRCN0000472312 TTCTAGCCAACCGTTCTGCATAGT pLX_317 48.6% 92.7% 99.6% V5 (many diffs) n/a
Download CSV