Transcript: Mouse NM_008756.2

Mus musculus occludin (Ocln), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Mus musculus (mouse)
Gene:
Ocln (18260)
Length:
3192
CDS:
180..1745

Additional Resources:

NCBI RefSeq record:
NM_008756.2
NBCI Gene record:
Ocln (18260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120880 CGGAAAGAGTTGACAGTCCAA pLKO.1 1120 CDS 100% 2.640 2.112 N Ocln n/a
2 TRCN0000120881 GCTCATTATTGTGATGTGCAT pLKO.1 389 CDS 100% 2.640 2.112 N Ocln n/a
3 TRCN0000159414 GCTCATTATTGTGATGTGCAT pLKO.1 389 CDS 100% 2.640 2.112 N OCLN n/a
4 TRCN0000120877 GCTCATTTGATGTCATTAGTA pLKO.1 2800 3UTR 100% 5.625 3.938 N Ocln n/a
5 TRCN0000120878 CGAAGAAAGATGGATCGGTAT pLKO.1 975 CDS 100% 4.050 2.835 N Ocln n/a
6 TRCN0000120879 GCTATGGCTATGGCGGATATA pLKO.1 547 CDS 100% 13.200 7.920 N Ocln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008756.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06667 pDONR223 100% 85.8% 89.6% None (many diffs) n/a
2 ccsbBroad304_06667 pLX_304 0% 85.8% 89.6% V5 (many diffs) n/a
3 TRCN0000469640 GCATCCATCTACTCGCACACCTTC pLX_317 27.2% 85.8% 89.6% V5 (many diffs) n/a
Download CSV