Transcript: Mouse NM_008769.4

Mus musculus ornithine transcarbamylase (Otc), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Otc (18416)
Length:
2319
CDS:
133..1197

Additional Resources:

NCBI RefSeq record:
NM_008769.4
NBCI Gene record:
Otc (18416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008769.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103386 GCCAGATCCTAATATAGTCAA pLKO.1 804 CDS 100% 4.950 6.930 N Otc n/a
2 TRCN0000103388 GTTACGATGAAGACTGCCAAA pLKO.1 988 CDS 100% 4.050 5.670 N Otc n/a
3 TRCN0000035099 CGAGTGTATAAACAATCAGAT pLKO.1 553 CDS 100% 4.950 3.960 N OTC n/a
4 TRCN0000103387 GATCCTAATATAGTCAAGCTA pLKO.1 808 CDS 100% 3.000 2.400 N Otc n/a
5 TRCN0000103389 GCAAGGGAAATCCTTAGGAAT pLKO.1 363 CDS 100% 4.950 3.465 N Otc n/a
6 TRCN0000103385 GCTTACAATGTCTAAGTCATT pLKO.1 1529 3UTR 100% 4.950 3.465 N Otc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008769.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01127 pDONR223 100% 89.1% 92.6% None (many diffs) n/a
2 ccsbBroad304_01127 pLX_304 0% 89.1% 92.6% V5 (many diffs) n/a
3 TRCN0000477562 AAATCAGATCTAGTCTCTTGGACG pLX_317 38.7% 89.1% 92.6% V5 (many diffs) n/a
Download CSV