Transcript: Mouse NM_008772.5

Mus musculus purinergic receptor P2Y, G-protein coupled 1 (P2ry1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
P2ry1 (18441)
Length:
3899
CDS:
658..1779

Additional Resources:

NCBI RefSeq record:
NM_008772.5
NBCI Gene record:
P2ry1 (18441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008772.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277287 CTTGGGCTGTTATGGATTAAT pLKO_005 1356 CDS 100% 15.000 21.000 N P2ry1 n/a
2 TRCN0000220778 CGTCCAATGATTACCTGCGAA pLKO.1 1274 CDS 100% 2.640 3.696 N P2ry1 n/a
3 TRCN0000277247 GTAAGATTTAGCGAGTCATTA pLKO_005 1965 3UTR 100% 13.200 10.560 N P2ry1 n/a
4 TRCN0000220776 CGACAGGGTTTATGCCACTTA pLKO.1 1554 CDS 100% 4.950 3.960 N P2ry1 n/a
5 TRCN0000345576 CGACAGGGTTTATGCCACTTA pLKO_005 1554 CDS 100% 4.950 3.960 N P2ry1 n/a
6 TRCN0000220774 CCTGCGAAGTTATTTCATCTA pLKO.1 1287 CDS 100% 4.950 3.465 N P2ry1 n/a
7 TRCN0000220777 GAGTGAAGAAATGACTCTCAA pLKO.1 1716 CDS 100% 4.950 3.465 N P2ry1 n/a
8 TRCN0000277288 GAGTGAAGAAATGACTCTCAA pLKO_005 1716 CDS 100% 4.950 3.465 N P2ry1 n/a
9 TRCN0000220775 GCTCAAGAAGAAGAATGCCAT pLKO.1 1143 CDS 100% 2.640 1.848 N P2ry1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008772.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489940 CGGGTAATCTATGTTAATCCTTGC pLX_317 41.2% 87.2% 94.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488311 AGTTCCTGAGAGGACCTCAACATC pLX_317 30.5% 87.1% 94.6% V5 (many diffs) n/a
3 ccsbBroadEn_01135 pDONR223 100% 87.1% 94.9% None (many diffs) n/a
4 ccsbBroad304_01135 pLX_304 0% 87.1% 94.9% V5 (many diffs) n/a
5 TRCN0000492318 CAAGAATAATTTTACTCCGATATC pLX_317 28.3% 87.1% 94.9% V5 (many diffs) n/a
Download CSV