Transcript: Mouse NM_008777.3

Mus musculus phenylalanine hydroxylase (Pah), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Pah (18478)
Length:
2152
CDS:
223..1584

Additional Resources:

NCBI RefSeq record:
NM_008777.3
NBCI Gene record:
Pah (18478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201362 GAACCTGATATCTGTCATGAA pLKO.1 1060 CDS 100% 4.950 6.930 N Pah n/a
2 TRCN0000190344 CGAAAGCAGTTTGCTGACATT pLKO.1 694 CDS 100% 4.950 3.465 N Pah n/a
3 TRCN0000190908 CTGGCCACAATTTACTGGTTT pLKO.1 1183 CDS 100% 4.950 3.465 N Pah n/a
4 TRCN0000191720 GAAGTATAGTAACTGCTTCTT pLKO.1 1642 3UTR 100% 4.950 3.465 N Pah n/a
5 TRCN0000189640 CCTGCGCTTATTTGAGGAGAA pLKO.1 375 CDS 100% 4.050 2.835 N Pah n/a
6 TRCN0000189948 GCATGGATCTAAGCCCATGTA pLKO.1 1032 CDS 100% 0.495 0.347 N Pah n/a
7 TRCN0000200500 CAGACCTTCAATTTGGTTTAA pLKO.1 1820 3UTR 100% 13.200 7.920 N Pah n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06685 pDONR223 100% 87% 92% None (many diffs) n/a
2 ccsbBroad304_06685 pLX_304 0% 87% 92% V5 (many diffs) n/a
3 TRCN0000473451 TCCATCCACTCCCCCTTCTAACAA pLX_317 33.9% 87% 92% V5 (many diffs) n/a
Download CSV