Transcript: Mouse NM_008791.3

Mus musculus Purkinje cell protein 4 (Pcp4), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pcp4 (18546)
Length:
658
CDS:
177..365

Additional Resources:

NCBI RefSeq record:
NM_008791.3
NBCI Gene record:
Pcp4 (18546)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177109 GAATTTGATATCGACATGGAT pLKO.1 261 CDS 100% 3.000 4.200 N Pcp4 n/a
2 TRCN0000181436 CAAGACGTCAGGAGATAATGA pLKO.1 218 CDS 100% 5.625 4.500 N Pcp4 n/a
3 TRCN0000197743 GTCCAAGAAGAATTTGATATC pLKO.1 252 CDS 100% 10.800 7.560 N Pcp4 n/a
4 TRCN0000177793 CAGAAGAAAGTCCAAGAAGAA pLKO.1 243 CDS 100% 4.950 3.465 N Pcp4 n/a
5 TRCN0000142911 CCATTCAGTCTCAGTTCAGAA pLKO.1 310 CDS 100% 4.950 3.465 N PCP4 n/a
6 TRCN0000181490 GCAGAAGAAAGTCCAAGAAGA pLKO.1 242 CDS 100% 4.950 3.465 N Pcp4 n/a
7 TRCN0000177390 GAAGAATTTGATATCGACATG pLKO.1 258 CDS 100% 4.050 2.835 N Pcp4 n/a
8 TRCN0000142558 GCCATTCAGTCTCAGTTCAGA pLKO.1 309 CDS 100% 3.000 2.100 N PCP4 n/a
9 TRCN0000182843 CAGGAGATAATGATGGGCAGA pLKO.1 226 CDS 100% 2.160 1.512 N Pcp4 n/a
10 TRCN0000182524 GTCAGGAGATAATGATGGGCA pLKO.1 224 CDS 100% 0.660 0.462 N Pcp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01154 pDONR223 100% 89.2% 96.7% None (many diffs) n/a
2 ccsbBroad304_01154 pLX_304 0% 89.2% 96.7% V5 (many diffs) n/a
3 TRCN0000468848 TGAGTGTGCCCTCCTCGTCATATT pLX_317 100% 89.2% 96.7% V5 (many diffs) n/a
Download CSV