Transcript: Mouse NM_008813.4

Mus musculus ectonucleotide pyrophosphatase/phosphodiesterase 1 (Enpp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Enpp1 (18605)
Length:
6791
CDS:
169..2886

Additional Resources:

NCBI RefSeq record:
NM_008813.4
NBCI Gene record:
Enpp1 (18605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008813.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425445 AGCGCTGCTTACATCTAATAT pLKO_005 2373 CDS 100% 15.000 21.000 N Enpp1 n/a
2 TRCN0000080634 CCCGTGTTTGACTTTGATTAT pLKO.1 2497 CDS 100% 13.200 18.480 N Enpp1 n/a
3 TRCN0000436447 CCGATTTGGGTGACCGCTAAT pLKO_005 1027 CDS 100% 10.800 15.120 N Enpp1 n/a
4 TRCN0000080635 CCAGAGACATACTATTCATTT pLKO.1 1501 CDS 100% 13.200 9.240 N Enpp1 n/a
5 TRCN0000426563 TGACGGGATTCTACCAGATAT pLKO_005 1101 CDS 100% 13.200 9.240 N Enpp1 n/a
6 TRCN0000080633 GCAGACTTCCTGTCTAAGAAT pLKO.1 3098 3UTR 100% 5.625 3.938 N Enpp1 n/a
7 TRCN0000080636 CCCATTTACAACCCAAGTCAT pLKO.1 1906 CDS 100% 4.950 3.465 N Enpp1 n/a
8 TRCN0000080637 CCTGTCATTAGCAAGCTGAAA pLKO.1 811 CDS 100% 4.950 3.465 N Enpp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008813.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13918 pDONR223 100% 78.4% 32.5% None (many diffs) n/a
2 ccsbBroad304_13918 pLX_304 0% 78.4% 32.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476126 GGAGCGGGATGCTAGAAGAAGTCC pLX_317 16.9% 78.4% 32.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV