Transcript: Mouse NM_008825.4

Mus musculus 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (Pfkfb2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pfkfb2 (18640)
Length:
7308
CDS:
122..1678

Additional Resources:

NCBI RefSeq record:
NM_008825.4
NBCI Gene record:
Pfkfb2 (18640)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008825.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024882 CCAACACTCATTGTTATGATT pLKO.1 239 CDS 100% 5.625 7.875 N Pfkfb2 n/a
2 TRCN0000274621 CCAACACTCATTGTTATGATT pLKO_005 239 CDS 100% 5.625 7.875 N Pfkfb2 n/a
3 TRCN0000024883 CCAGACAACTATGATAAGGAT pLKO.1 743 CDS 100% 3.000 4.200 N Pfkfb2 n/a
4 TRCN0000274619 CACTCCTGTCCCAACGTTAAT pLKO_005 1751 3UTR 100% 13.200 10.560 N Pfkfb2 n/a
5 TRCN0000024880 CGTCCAAGAAATTACAGTGTT pLKO.1 1559 CDS 100% 4.950 3.960 N Pfkfb2 n/a
6 TRCN0000274618 GACTGCAACAGCAGCTATAAA pLKO_005 152 CDS 100% 15.000 10.500 N Pfkfb2 n/a
7 TRCN0000323503 CAGAATGCCTTCAAGGTATTT pLKO_005 563 CDS 100% 13.200 9.240 N Pfkfb2 n/a
8 TRCN0000361451 CAACTATGATAAGGATCTTTC pLKO_005 748 CDS 100% 10.800 7.560 N Pfkfb2 n/a
9 TRCN0000361450 CTCTTGCCCTTGCCACTAATC pLKO_005 1704 3UTR 100% 10.800 7.560 N Pfkfb2 n/a
10 TRCN0000024879 CCCACCAAAGTGTTTAATCTT pLKO.1 329 CDS 100% 5.625 3.938 N Pfkfb2 n/a
11 TRCN0000024881 CCAGAGTAAGATTGTCTACTA pLKO.1 829 CDS 100% 4.950 3.465 N Pfkfb2 n/a
12 TRCN0000274620 CCAGAGTAAGATTGTCTACTA pLKO_005 829 CDS 100% 4.950 3.465 N Pfkfb2 n/a
13 TRCN0000037959 CCTGATGTCATTGCTGCCAAT pLKO.1 608 CDS 100% 4.050 2.835 N PFKFB2 n/a
14 TRCN0000333302 CCTGATGTCATTGCTGCCAAT pLKO_005 608 CDS 100% 4.050 2.835 N PFKFB2 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3376 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008825.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14743 pDONR223 100% 86.4% 43.5% None (many diffs) n/a
2 ccsbBroad304_14743 pLX_304 0% 86.4% 43.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV