Transcript: Mouse NM_008856.4

Mus musculus protein kinase C, eta (Prkch), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Prkch (18755)
Length:
3546
CDS:
368..2419

Additional Resources:

NCBI RefSeq record:
NM_008856.4
NBCI Gene record:
Prkch (18755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008856.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361369 GGGTCTCCAACCCGGAAATAT pLKO_005 1294 CDS 100% 15.000 21.000 N Prkch n/a
2 TRCN0000361433 CCATCAAGTGAACGGACATAA pLKO_005 865 CDS 100% 13.200 18.480 N Prkch n/a
3 TRCN0000022809 CCCGTCTTAACTCCGATTGAT pLKO.1 2324 CDS 100% 5.625 7.875 N Prkch n/a
4 TRCN0000022813 CCGATTGATGAGGGACATCTT pLKO.1 2336 CDS 100% 4.950 6.930 N Prkch n/a
5 TRCN0000022811 CGACAAGGACTTCAGTGTAAA pLKO.1 1178 CDS 100% 13.200 10.560 N Prkch n/a
6 TRCN0000022812 CCTACATGAGAAAGGTATCAT pLKO.1 1774 CDS 100% 5.625 4.500 N Prkch n/a
7 TRCN0000006295 GCTGCCATCATCTAATTGTTA pLKO.1 1005 CDS 100% 5.625 4.500 N PRKCH n/a
8 TRCN0000022810 CCTAGAATCAAATCCCGAGAA pLKO.1 2264 CDS 100% 4.050 3.240 N Prkch n/a
9 TRCN0000361370 TGCACCTGCGTCGTCCATAAA pLKO_005 983 CDS 100% 13.200 9.240 N Prkch n/a
10 TRCN0000413357 TGCTGAAGAAGGACGTGATTC pLKO_005 1521 CDS 100% 10.800 6.480 N PRKCH n/a
11 TRCN0000006298 CCAGGATGAGTTTAGAAACTT pLKO.1 2368 CDS 100% 5.625 3.375 N PRKCH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008856.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14792 pDONR223 0% 89.9% 97.6% None (many diffs) n/a
2 ccsbBroad304_14792 pLX_304 0% 89.9% 97.6% V5 (many diffs) n/a
3 TRCN0000491934 ATCATCAGAGAAGGCTGTCTTTCT pLX_317 9.9% 89.9% 97.6% V5 (many diffs) n/a
4 TRCN0000491456 TTGACCTCCGAGAGACATACCCTT pLX_317 15.3% 89.9% 97.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV