Transcript: Mouse NM_008917.3

Mus musculus palmitoyl-protein thioesterase 1 (Ppt1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ppt1 (19063)
Length:
2493
CDS:
30..950

Additional Resources:

NCBI RefSeq record:
NM_008917.3
NBCI Gene record:
Ppt1 (19063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191270 CCATACAAATTTGGAGCAAAT pLKO.1 1301 3UTR 100% 10.800 8.640 N Ppt1 n/a
2 TRCN0000292728 CCATACAAATTTGGAGCAAAT pLKO_005 1301 3UTR 100% 10.800 8.640 N Ppt1 n/a
3 TRCN0000202003 CGACTCTGAGTGGTTTGGATT pLKO.1 746 CDS 100% 4.950 3.960 N Ppt1 n/a
4 TRCN0000292729 CGACTCTGAGTGGTTTGGATT pLKO_005 746 CDS 100% 4.950 3.960 N Ppt1 n/a
5 TRCN0000200867 GTTTGTGATGGTGAAATTCTT pLKO.1 701 CDS 100% 5.625 3.938 N Ppt1 n/a
6 TRCN0000292658 GTTTGTGATGGTGAAATTCTT pLKO_005 701 CDS 100% 5.625 3.938 N Ppt1 n/a
7 TRCN0000202373 GCAGCAGGGATACAATGCTAT pLKO.1 344 CDS 100% 4.950 3.465 N Ppt1 n/a
8 TRCN0000292730 GCAGCAGGGATACAATGCTAT pLKO_005 344 CDS 100% 4.950 3.465 N Ppt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01271 pDONR223 100% 84.8% 85.2% None (many diffs) n/a
2 ccsbBroad304_01271 pLX_304 0% 84.8% 85.2% V5 (many diffs) n/a
Download CSV