Transcript: Mouse NM_008950.1

Mus musculus protease (prosome, macropain) 26S subunit, ATPase 5 (Psmc5), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Psmc5 (19184)
Length:
1277
CDS:
7..1227

Additional Resources:

NCBI RefSeq record:
NM_008950.1
NBCI Gene record:
Psmc5 (19184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020260 CAAGGTTATCATGGCTACTAA pLKO.1 873 CDS 100% 5.625 4.500 N PSMC5 n/a
2 TRCN0000352809 CAAGGTTATCATGGCTACTAA pLKO_005 873 CDS 100% 5.625 4.500 N PSMC5 n/a
3 TRCN0000304284 GTCCATCCTGAGGGCAAATTT pLKO_005 271 CDS 100% 15.000 10.500 N Psmc5 n/a
4 TRCN0000065772 GCTCTGAACTGGTACAGAAAT pLKO.1 653 CDS 100% 13.200 9.240 N Psmc5 n/a
5 TRCN0000301559 GCTCTGAACTGGTACAGAAAT pLKO_005 653 CDS 100% 13.200 9.240 N Psmc5 n/a
6 TRCN0000348943 TCAACGATGTGACGCCCAATT pLKO_005 320 CDS 100% 10.800 7.560 N Psmc5 n/a
7 TRCN0000065768 CCACCAAGAATATCAAGGTTA pLKO.1 860 CDS 100% 4.950 3.465 N Psmc5 n/a
8 TRCN0000301557 CCACCAAGAATATCAAGGTTA pLKO_005 860 CDS 100% 4.950 3.465 N Psmc5 n/a
9 TRCN0000065771 GCACAGAGGAATGAGCTGAAT pLKO.1 145 CDS 100% 4.950 3.465 N Psmc5 n/a
10 TRCN0000301558 GCACAGAGGAATGAGCTGAAT pLKO_005 145 CDS 100% 4.950 3.465 N Psmc5 n/a
11 TRCN0000065769 CCGTCAATATTATCTGTCCAA pLKO.1 66 CDS 100% 2.640 1.848 N Psmc5 n/a
12 TRCN0000065770 CGCTCTAAGAAATGACAGCTA pLKO.1 348 CDS 100% 2.640 1.848 N Psmc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01317 pDONR223 100% 90.2% 100% None (many diffs) n/a
2 ccsbBroad304_01317 pLX_304 0% 90.2% 100% V5 (many diffs) n/a
3 TRCN0000465850 AGTTCACTATCAATGTATGGCTTT pLX_317 32.9% 90.1% 99.7% V5 (many diffs) n/a
Download CSV