Transcript: Mouse NM_008961.3

Mus musculus phosphotriesterase related (Pter), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pter (19212)
Length:
3621
CDS:
185..1234

Additional Resources:

NCBI RefSeq record:
NM_008961.3
NBCI Gene record:
Pter (19212)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008961.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101741 CCATTCCAGATAATCCGTATA pLKO.1 809 CDS 100% 10.800 15.120 N Pter n/a
2 TRCN0000332460 CCATTCCAGATAATCCGTATA pLKO_005 809 CDS 100% 10.800 15.120 N Pter n/a
3 TRCN0000101742 CCCTAAACAATGGCTGACTTT pLKO.1 1207 CDS 100% 4.950 6.930 N Pter n/a
4 TRCN0000101743 GTGTGGAGTTATTGGAGAAAT pLKO.1 673 CDS 100% 13.200 9.240 N Pter n/a
5 TRCN0000332461 GTGTGGAGTTATTGGAGAAAT pLKO_005 673 CDS 100% 13.200 9.240 N Pter n/a
6 TRCN0000101744 CCATCGAGAGAACCTTCAGTT pLKO.1 382 CDS 100% 4.950 3.465 N Pter n/a
7 TRCN0000332462 CCATCGAGAGAACCTTCAGTT pLKO_005 382 CDS 100% 4.950 3.465 N Pter n/a
8 TRCN0000101740 CCCATTGTCTTTCCTTAATAA pLKO.1 1418 3UTR 100% 15.000 9.000 N Pter n/a
9 TRCN0000332529 CCCATTGTCTTTCCTTAATAA pLKO_005 1418 3UTR 100% 15.000 9.000 N Pter n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008961.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15665 pDONR223 0% 84.7% 87.6% None (many diffs) n/a
2 ccsbBroad304_15665 pLX_304 0% 84.7% 87.6% V5 (many diffs) n/a
3 TRCN0000474489 TTCCATCTACTATGCACCTCGTTC pLX_317 45.2% 84.7% 87.6% V5 (many diffs) n/a
4 ccsbBroadEn_02135 pDONR223 100% 84.7% 87.6% None (many diffs) n/a
5 ccsbBroad304_02135 pLX_304 0% 84.7% 87.6% V5 (many diffs) n/a
6 TRCN0000475259 GCCCTCTTCTGATACGAGTCATCG pLX_317 34.3% 84.7% 87.6% V5 (many diffs) n/a
Download CSV