Transcript: Mouse NM_008996.3

Mus musculus RAB1A, member RAS oncogene family (Rab1a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rab1a (19324)
Length:
2657
CDS:
29..646

Additional Resources:

NCBI RefSeq record:
NM_008996.3
NBCI Gene record:
Rab1a (19324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008996.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418702 GGTTTGCAGATGATACGTATA pLKO_005 117 CDS 100% 10.800 15.120 N Rab1a n/a
2 TRCN0000423683 AGATACGAACTATAGAGTTAG pLKO_005 174 CDS 100% 10.800 8.640 N Rab1a n/a
3 TRCN0000442109 GTGCTAAGAACGCAACGAATG pLKO_005 489 CDS 100% 6.000 4.800 N Rab1a n/a
4 TRCN0000100860 GCCAGAAATTACAGGTTTATT pLKO.1 2492 3UTR 100% 15.000 10.500 N Rab1a n/a
5 TRCN0000382070 CAGATCAGGAGTCCTTCAATA pLKO_005 309 CDS 100% 13.200 9.240 N RAB1A n/a
6 TRCN0000100863 CGAACAATCACTTCCAGTTAT pLKO.1 248 CDS 100% 13.200 9.240 N Rab1a n/a
7 TRCN0000100862 GAAAGCTACATCAGCACAATT pLKO.1 140 CDS 100% 13.200 9.240 N Rab1a n/a
8 TRCN0000100861 GCCGAGAAGTCCAATGTTAAA pLKO.1 581 CDS 100% 13.200 9.240 N Rab1a n/a
9 TRCN0000422136 GAGATTGTAAATGGTCAATAC pLKO_005 774 3UTR 100% 10.800 7.560 N Rab1a n/a
10 TRCN0000420471 GTTACTTCTGATTGGCGATTC pLKO_005 67 CDS 100% 6.000 4.200 N Rab1a n/a
11 TRCN0000381618 GGAGCCCATGGCATCATAGTT pLKO_005 275 CDS 100% 5.625 3.938 N RAB1A n/a
12 TRCN0000158079 CAGGCCAGGAAAGATTTCGAA pLKO.1 231 CDS 100% 3.000 2.100 N RAB1A n/a
13 TRCN0000280676 CAGGCCAGGAAAGATTTCGAA pLKO_005 231 CDS 100% 3.000 2.100 N RAB1A n/a
14 TRCN0000100864 CAAGTTGTTGGTAGGGAACAA pLKO.1 382 CDS 100% 0.495 0.347 N Rab1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008996.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01357 pDONR223 100% 95.6% 100% None (many diffs) n/a
2 ccsbBroad304_01357 pLX_304 0% 95.6% 100% V5 (many diffs) n/a
3 TRCN0000466775 CTTCGATGTAGACACAACAGCAAG pLX_317 62.2% 95.6% 100% V5 (many diffs) n/a
Download CSV