Transcript: Mouse NM_009081.2

Mus musculus ribosomal protein L28 (Rpl28), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rpl28 (19943)
Length:
496
CDS:
43..456

Additional Resources:

NCBI RefSeq record:
NM_009081.2
NBCI Gene record:
Rpl28 (19943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009081.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431002 CGGAGCCAAATAATCTGAAAG pLKO_005 122 CDS 100% 10.800 5.400 Y Rpl28 n/a
2 TRCN0000438156 GGGTCGTGGTAGTTATGAAAC pLKO_005 218 CDS 100% 10.800 5.400 Y Rpl28 n/a
3 TRCN0000447430 GAGGACCACCATCAACAAGAA pLKO_005 276 CDS 100% 4.950 2.475 Y Rpl28 n/a
4 TRCN0000428714 GCTCCAGTTTCTTGATCAAGA pLKO_005 80 CDS 100% 4.950 2.475 Y Rpl28 n/a
5 TRCN0000104191 AGAGGAATAAGCAGACGTACA pLKO.1 98 CDS 100% 4.050 2.025 Y Rpl28 n/a
6 TRCN0000104192 CATCAGACACATGATCCGAAA pLKO.1 318 CDS 100% 4.050 2.025 Y Rpl28 n/a
7 TRCN0000104193 CCACTTCTTATGTGAGGACCA pLKO.1 263 CDS 100% 2.160 1.080 Y Rpl28 n/a
8 TRCN0000104194 TCAACAAGAATGCTCGGGCTA pLKO.1 287 CDS 100% 2.160 1.080 Y Rpl28 n/a
9 TRCN0000104190 GACGTACAGCACGGAGCCAAA pLKO.1 111 CDS 100% 1.350 0.675 Y Rpl28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009081.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01432 pDONR223 100% 89.2% 98.5% None (many diffs) n/a
2 ccsbBroad304_01432 pLX_304 0% 89.2% 98.5% V5 (many diffs) n/a
3 TRCN0000471204 CGAAAGAAACAAATAACCACCTCA pLX_317 100% 89.2% 98.5% V5 (many diffs) n/a
4 ccsbBroadEn_06885 pDONR223 100% 89% 97.8% None (many diffs) n/a
5 ccsbBroad304_06885 pLX_304 0% 89% 97.8% V5 (many diffs) n/a
6 TRCN0000468159 CACGAACTCGTGCGTGTGCCACAA pLX_317 81.2% 89% 97.8% V5 (many diffs) n/a
Download CSV