Transcript: Mouse NM_009092.3

Mus musculus ribosomal protein S17 (Rps17), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rps17 (20068)
Length:
489
CDS:
31..438

Additional Resources:

NCBI RefSeq record:
NM_009092.3
NBCI Gene record:
Rps17 (20068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009092.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104412 AGAGAGAGAGAGGAGAGATAA pLKO.1 258 CDS 100% 13.200 6.600 Y Rps17 n/a
2 TRCN0000104410 GCCCTAGATCAGGAGATCATT pLKO.1 298 CDS 100% 5.625 2.813 Y Rps17 n/a
3 TRCN0000104411 CCGGGTCATCATCGAGAAGTA pLKO.1 69 CDS 100% 4.950 2.475 Y Rps17 n/a
4 TRCN0000104414 CGGCTATGTCACGCATCTGAT pLKO.1 183 CDS 100% 4.950 2.475 Y Rps17 n/a
5 TRCN0000104413 GAGAGGCATCTCTATCAAGTT pLKO.1 228 CDS 100% 4.950 2.475 Y Rps17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009092.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15582 pDONR223 0% 89.3% 99.2% None (many diffs) n/a
2 ccsbBroad304_15582 pLX_304 0% 89.3% 99.2% V5 (many diffs) n/a
3 TRCN0000471869 ACCTGATCCCCATTCCCTATATGT pLX_317 92.7% 89.3% 99.2% V5 (many diffs) n/a
4 ccsbBroadEn_06900 pDONR223 100% 88.8% 98.5% None (many diffs) n/a
5 ccsbBroad304_06900 pLX_304 0% 88.8% 98.5% V5 (many diffs) n/a
6 TRCN0000469943 GTAAATTCATTACACTTATCCACG pLX_317 100% 88.8% 98.5% V5 (many diffs) n/a
Download CSV