Transcript: Mouse NM_009133.3

Mus musculus stathmin-like 3 (Stmn3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Stmn3 (20262)
Length:
1136
CDS:
289..831

Additional Resources:

NCBI RefSeq record:
NM_009133.3
NBCI Gene record:
Stmn3 (20262)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009133.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250681 ATGTCTGGCTAAGGAGTATTG pLKO_005 820 CDS 100% 10.800 15.120 N Stmn3 n/a
2 TRCN0000183015 CAATTCTGTCTAGATGCGAAT pLKO.1 885 3UTR 100% 4.050 5.670 N Stmn3 n/a
3 TRCN0000250680 ATTCTGTCTAGATGCGAATTT pLKO_005 887 3UTR 100% 13.200 10.560 N Stmn3 n/a
4 TRCN0000250684 CGAACACCATCTACCAGTATG pLKO_005 380 CDS 100% 10.800 7.560 N Stmn3 n/a
5 TRCN0000250683 GGAAGTGAAGCAGCTGGATAA pLKO_005 408 CDS 100% 10.800 7.560 N Stmn3 n/a
6 TRCN0000216619 GAGAAGATGAAGGAGTTATCT pLKO.1 316 CDS 100% 5.625 3.938 N Stmn3 n/a
7 TRCN0000196155 GCTCATTTGCTCCTGCTTCTA pLKO.1 345 CDS 100% 4.950 3.465 N Stmn3 n/a
8 TRCN0000184270 GCTCAACTACAAGATGGAGCT pLKO.1 693 CDS 100% 2.160 1.512 N Stmn3 n/a
9 TRCN0000250682 TATCTGTGCTGTCGCTCATTT pLKO_005 332 CDS 100% 13.200 7.920 N Stmn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009133.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03160 pDONR223 100% 89% 96.1% None (many diffs) n/a
2 ccsbBroad304_03160 pLX_304 0% 89% 96.1% V5 (many diffs) n/a
3 TRCN0000471016 TTACCCTGTGGCAGGCATAGTCTG pLX_317 66.7% 89% 96.1% V5 (many diffs) n/a
Download CSV