Transcript: Mouse NM_009162.3

Mus musculus secretogranin V (Scg5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Scg5 (20394)
Length:
1227
CDS:
101..739

Additional Resources:

NCBI RefSeq record:
NM_009162.3
NBCI Gene record:
Scg5 (20394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009162.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106518 AGGAGTGTCAATCCCTATCTA pLKO.1 641 CDS 100% 5.625 3.938 N Scg5 n/a
2 TRCN0000106516 GACAATGTTGTGGCAAAGAAA pLKO.1 677 CDS 100% 5.625 3.938 N Scg5 n/a
3 TRCN0000106515 CGGATATGAAATACTCAGATT pLKO.1 977 3UTR 100% 4.950 3.465 N Scg5 n/a
4 TRCN0000106517 TGGTTGATGTTTGAGTGGAAT pLKO.1 146 CDS 100% 4.950 3.465 N Scg5 n/a
5 TRCN0000106519 CCTAAGGACTTCAGTGAGGAT pLKO.1 410 CDS 100% 2.640 1.848 N Scg5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009162.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06942 pDONR223 100% 87.5% 91.5% None (many diffs) n/a
2 ccsbBroad304_06942 pLX_304 0% 87.5% 91.5% V5 (many diffs) n/a
3 TRCN0000465991 TCAGACGAGTGTAGCCCGCCATTG pLX_317 56.7% 87.5% 91.5% V5 (many diffs) n/a
Download CSV