Transcript: Mouse NM_009169.2

Mus musculus SEM1, 26S proteasome complex subunit (Sem1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sem1 (20422)
Length:
491
CDS:
105..317

Additional Resources:

NCBI RefSeq record:
NM_009169.2
NBCI Gene record:
Sem1 (20422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189589 CTCTAACCAGTTACGTGCTGA pLKO.1 260 CDS 100% 2.640 2.112 N Sem1 n/a
2 TRCN0000293073 CACATGTCTGGGAGGATAATT pLKO_005 211 CDS 100% 15.000 10.500 N Sem1 n/a
3 TRCN0000191721 GATAATTGGGATGATGACAAT pLKO.1 225 CDS 100% 4.950 3.465 N Sem1 n/a
4 TRCN0000298123 GATAATTGGGATGATGACAAT pLKO_005 225 CDS 100% 4.950 3.465 N Sem1 n/a
5 TRCN0000200793 GATGATGACAATGTAGAAGAT pLKO.1 234 CDS 100% 4.950 3.465 N Sem1 n/a
6 TRCN0000192786 GCTACAAGATGGAGACATCAT pLKO.1 295 CDS 100% 4.950 3.465 N Sem1 n/a
7 TRCN0000083697 GCTGGCTTAGATGAAGATGAA pLKO.1 186 CDS 100% 4.950 3.465 N SEM1 n/a
8 TRCN0000192907 GCTGGCTTAGATGAAGATGAA pLKO.1 186 CDS 100% 4.950 3.465 N Sem1 n/a
9 TRCN0000291694 GCTGGCTTAGATGAAGATGAA pLKO_005 186 CDS 100% 4.950 3.465 N SEM1 n/a
10 TRCN0000293063 GCTGGCTTAGATGAAGATGAA pLKO_005 186 CDS 100% 4.950 3.465 N Sem1 n/a
11 TRCN0000293065 ACGACGAGTTCGAGGAGTTTC pLKO_005 151 CDS 100% 10.800 6.480 N Sem1 n/a
12 TRCN0000200669 GATGAAGATGAAGATGCACAT pLKO.1 195 CDS 100% 4.050 2.430 N Sem1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01850 pDONR223 100% 88.5% 100% None (many diffs) n/a
2 ccsbBroad304_01850 pLX_304 0% 88.5% 100% V5 (many diffs) n/a
3 TRCN0000474393 GAACTTTTCCATACTTAAGAAATT pLX_317 100% 88.5% 100% V5 (many diffs) n/a
Download CSV