Transcript: Mouse NM_009195.3

Mus musculus solute carrier family 12, member 4 (Slc12a4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc12a4 (20498)
Length:
3826
CDS:
77..3334

Additional Resources:

NCBI RefSeq record:
NM_009195.3
NBCI Gene record:
Slc12a4 (20498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009195.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350038 GTGAGGGTTGATACGGGATTT pLKO_005 3576 3UTR 100% 10.800 15.120 N Slc12a4 n/a
2 TRCN0000350036 GGGCAAGCTTGTCAGCTATAC pLKO_005 325 CDS 100% 10.800 8.640 N Slc12a4 n/a
3 TRCN0000068334 CGTGCCTGGAAGACCTTTATT pLKO.1 2492 CDS 100% 15.000 10.500 N Slc12a4 n/a
4 TRCN0000350087 ACGTGCCTGGAAGACCTTTAT pLKO_005 2491 CDS 100% 13.200 9.240 N Slc12a4 n/a
5 TRCN0000068335 CTTGAATAACATGAGAGTGTA pLKO.1 817 CDS 100% 4.950 3.465 N Slc12a4 n/a
6 TRCN0000068333 GCAGACCATCAAGAACATGAT pLKO.1 2314 CDS 100% 4.950 3.465 N Slc12a4 n/a
7 TRCN0000042935 CCAGTTTGACATCTGTGCCAA pLKO.1 1030 CDS 100% 2.640 1.848 N SLC12A4 n/a
8 TRCN0000232783 AGATCTTGCTGACCTACATTG pLKO_005 741 CDS 100% 10.800 6.480 N SLC12A4 n/a
9 TRCN0000350052 AGATCTTGCTGACCTACATTG pLKO_005 741 CDS 100% 10.800 6.480 N Slc12a4 n/a
10 TRCN0000068337 CAGGGTAACCACAGAGAGAAT pLKO.1 194 CDS 100% 4.950 2.970 N Slc12a4 n/a
11 TRCN0000317864 CAGGGTAACCACAGAGAGAAT pLKO_005 194 CDS 100% 4.950 2.970 N Slc12a4 n/a
12 TRCN0000068336 GCGACGAGAACTACATGGAAT pLKO.1 3231 CDS 100% 4.950 2.970 N Slc12a4 n/a
13 TRCN0000042936 TGCACATTAAGCCGGACCAAT pLKO.1 3096 CDS 100% 4.950 6.930 N SLC12A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009195.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06965 pDONR223 100% 89.2% 96.2% None (many diffs) n/a
2 ccsbBroad304_06965 pLX_304 0% 89.2% 96.2% V5 (many diffs) n/a
3 TRCN0000469900 GCAACCCAAGTTAATCTTAAGTGA pLX_317 12% 89.2% 96.2% V5 (many diffs) n/a
Download CSV