Transcript: Mouse NM_009199.2

Mus musculus solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (Slc1a1), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Slc1a1 (20510)
Length:
3708
CDS:
77..1648

Additional Resources:

NCBI RefSeq record:
NM_009199.2
NBCI Gene record:
Slc1a1 (20510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070189 GCTGATCGTATCCAGCATGAT pLKO.1 283 CDS 100% 4.950 6.930 N Slc1a1 n/a
2 TRCN0000070190 CCAGATCATCATGTGCTACAT pLKO.1 826 CDS 100% 4.950 3.465 N Slc1a1 n/a
3 TRCN0000070191 CGTGGTACTAGGAATTGTCTT pLKO.1 157 CDS 100% 4.950 3.465 N Slc1a1 n/a
4 TRCN0000070192 CGTGTTTATTGCGCAACTGAA pLKO.1 1207 CDS 100% 4.950 3.465 N Slc1a1 n/a
5 TRCN0000043346 GCTGGGAAGATCATAGAAGTT pLKO.1 872 CDS 100% 4.950 3.465 N SLC1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06954 pDONR223 100% 85.6% 89.8% None (many diffs) n/a
2 ccsbBroad304_06954 pLX_304 0% 85.6% 89.8% V5 (many diffs) n/a
3 TRCN0000481203 CTGATTTCTGGCCTATTCTCAGTC pLX_317 26% 85.6% 89.8% V5 (many diffs) n/a
Download CSV