Transcript: Mouse NM_009223.3

Mus musculus stannin (Snn), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Snn (20621)
Length:
2919
CDS:
238..504

Additional Resources:

NCBI RefSeq record:
NM_009223.3
NBCI Gene record:
Snn (20621)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152843 GCTACTACTGTAATGCGTGAA pLKO.1 796 3UTR 100% 4.050 5.670 N SNN n/a
2 TRCN0000246681 TTCTACTGGTGCAGTACTCTG pLKO_005 416 CDS 100% 4.050 5.670 N Snn n/a
3 TRCN0000246679 CTTGGATCTACACCGAAATTT pLKO_005 2219 3UTR 100% 15.000 12.000 N Snn n/a
4 TRCN0000173567 GCTTGGATCTACACCGAAATT pLKO.1 2218 3UTR 100% 13.200 10.560 N Snn n/a
5 TRCN0000257535 GGTGGTAACGGTCATTGTCAT pLKO_005 270 CDS 100% 4.950 3.465 N Snn n/a
6 TRCN0000246680 CAAGTTGATGACCGCCAACAG pLKO_005 465 CDS 100% 4.050 2.835 N Snn n/a
7 TRCN0000246682 CATCAGCCAGTCAGAGGATGA pLKO_005 357 CDS 100% 4.050 2.835 N Snn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01886 pDONR223 100% 89% 97.7% None (many diffs) n/a
2 ccsbBroad304_01886 pLX_304 0% 89% 97.7% V5 (many diffs) n/a
3 TRCN0000467293 GAACAAGGCTCTTGCCCGTGGTAT pLX_317 100% 89% 97.7% V5 (many diffs) n/a
Download CSV