Transcript: Mouse NM_009224.5

Mus musculus small nuclear ribonucleoprotein 70 (U1) (Snrnp70), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Snrnp70 (20637)
Length:
1751
CDS:
245..1591

Additional Resources:

NCBI RefSeq record:
NM_009224.5
NBCI Gene record:
Snrnp70 (20637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009224.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294643 GAGATGACACTTCCCGATATG pLKO_005 882 CDS 100% 10.800 15.120 N Snrnp70 n/a
2 TRCN0000109161 GCACCATACATCCGAGAGTTT pLKO.1 368 CDS 100% 4.950 6.930 N Snrnp70 n/a
3 TRCN0000287201 GCACCATACATCCGAGAGTTT pLKO_005 368 CDS 100% 4.950 6.930 N Snrnp70 n/a
4 TRCN0000294705 ATCCACATGGTATACAGTAAA pLKO_005 638 CDS 100% 13.200 9.240 N Snrnp70 n/a
5 TRCN0000109163 CCCAGAGAATGGATATCTGAT pLKO.1 1552 CDS 100% 4.950 3.465 N Snrnp70 n/a
6 TRCN0000109162 CGATGCCTTCAAGACTCTGTT pLKO.1 541 CDS 100% 4.950 3.465 N Snrnp70 n/a
7 TRCN0000287138 CGATGCCTTCAAGACTCTGTT pLKO_005 541 CDS 100% 4.950 3.465 N Snrnp70 n/a
8 TRCN0000109160 CCTAATCTTGCTGTCTGCCTT pLKO.1 1614 3UTR 100% 2.640 1.848 N Snrnp70 n/a
9 TRCN0000109164 GCCTTCATCGAGTATGAGCAT pLKO.1 683 CDS 100% 2.640 1.848 N Snrnp70 n/a
10 TRCN0000287200 GCCTTCATCGAGTATGAGCAT pLKO_005 683 CDS 100% 2.640 1.848 N Snrnp70 n/a
11 TRCN0000000015 GACATGCACTCCGCTTACAAA pLKO.1 710 CDS 100% 5.625 7.875 N SNRNP70 n/a
12 TRCN0000349622 GACATGCACTCCGCTTACAAA pLKO_005 710 CDS 100% 5.625 7.875 N SNRNP70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009224.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06982 pDONR223 100% 84.2% 94.8% None (many diffs) n/a
2 ccsbBroad304_06982 pLX_304 0% 84.2% 94.8% V5 (many diffs) n/a
3 TRCN0000480471 CTCGCGGACACAGTTATGTTCTCA pLX_317 27.3% 84.2% 94.8% V5 (many diffs) n/a
Download CSV