Transcript: Mouse NM_009295.2

Mus musculus syntaxin binding protein 1 (Stxbp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Stxbp1 (20910)
Length:
3874
CDS:
142..1926

Additional Resources:

NCBI RefSeq record:
NM_009295.2
NBCI Gene record:
Stxbp1 (20910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009295.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093392 CGTGTCCAGATGCCCTATTTA pLKO.1 467 CDS 100% 15.000 21.000 N Stxbp1 n/a
2 TRCN0000336197 GACAAGCTGGATGCCTATAAA pLKO_005 760 CDS 100% 15.000 21.000 N Stxbp1 n/a
3 TRCN0000336137 CAAGCTTGGTTGGATTCATTT pLKO_005 2305 3UTR 100% 13.200 18.480 N Stxbp1 n/a
4 TRCN0000336199 TCGTGTCCAGATGCCCTATTT pLKO_005 466 CDS 100% 13.200 18.480 N Stxbp1 n/a
5 TRCN0000093391 GCCCTATTTAACGAGCTGGTA pLKO.1 478 CDS 100% 2.640 3.696 N Stxbp1 n/a
6 TRCN0000379438 ACATTCCAGGCTATGAGTTAT pLKO_005 883 CDS 100% 13.200 9.240 N Stxbp1 n/a
7 TRCN0000381883 ATGACCGAGGGCATCACAATT pLKO_005 292 CDS 100% 13.200 9.240 N Stxbp1 n/a
8 TRCN0000093393 CACGCTGAAGAAGCTGAATAA pLKO.1 1881 CDS 100% 13.200 9.240 N Stxbp1 n/a
9 TRCN0000379629 CCACTCTCTGATCAGTGATTT pLKO_005 393 CDS 100% 13.200 9.240 N Stxbp1 n/a
10 TRCN0000093390 CCCGATCATTAAAGACATTAT pLKO.1 1578 CDS 100% 13.200 9.240 N Stxbp1 n/a
11 TRCN0000336136 CCGATCATTAAAGACATTATG pLKO_005 1579 CDS 100% 13.200 9.240 N Stxbp1 n/a
12 TRCN0000336198 CGCTGACGGAAATCAACATTG pLKO_005 527 CDS 100% 10.800 7.560 N Stxbp1 n/a
13 TRCN0000093389 CCTCAGTTTAAGATACTTCAT pLKO.1 2780 3UTR 100% 4.950 3.465 N Stxbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009295.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01618 pDONR223 100% 90.8% 100% None (many diffs) n/a
2 ccsbBroad304_01618 pLX_304 0% 90.8% 100% V5 (many diffs) n/a
3 TRCN0000470555 AAACTTCGACCTTTGTGTATGGTA pLX_317 8.3% 90.8% 100% V5 (many diffs) n/a
Download CSV