Transcript: Mouse NM_009323.2

Mus musculus T-box 15 (Tbx15), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tbx15 (21384)
Length:
3585
CDS:
122..1930

Additional Resources:

NCBI RefSeq record:
NM_009323.2
NBCI Gene record:
Tbx15 (21384)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084360 CGCGTCTCAAAGCACTTTACT pLKO.1 1729 CDS 100% 5.625 7.875 N Tbx15 n/a
2 TRCN0000334007 CGCGTCTCAAAGCACTTTACT pLKO_005 1729 CDS 100% 5.625 7.875 N Tbx15 n/a
3 TRCN0000084361 GTAATCTAAACCTCTCTGATT pLKO.1 1296 CDS 100% 4.950 6.930 N Tbx15 n/a
4 TRCN0000333929 GTAATCTAAACCTCTCTGATT pLKO_005 1296 CDS 100% 4.950 6.930 N Tbx15 n/a
5 TRCN0000084362 CCACATCAGCAATACTATATA pLKO.1 584 CDS 100% 15.000 10.500 N Tbx15 n/a
6 TRCN0000334005 CCACATCAGCAATACTATATA pLKO_005 584 CDS 100% 15.000 10.500 N Tbx15 n/a
7 TRCN0000084359 CGCAAAGACTTTAGCAGTGAT pLKO.1 863 CDS 100% 4.950 3.465 N Tbx15 n/a
8 TRCN0000333928 CGCAAAGACTTTAGCAGTGAT pLKO_005 863 CDS 100% 4.950 3.465 N Tbx15 n/a
9 TRCN0000084358 ACAACAATAGATACCGCTGAA pLKO.1 2088 3UTR 100% 4.050 2.835 N Tbx15 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2277 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07035 pDONR223 100% 76.5% 81.5% None (many diffs) n/a
2 TRCN0000468373 TTTGGCTTTTTCACCGCCTACTGA pLX_317 26.9% 76.5% 81.5% V5 (many diffs) n/a
Download CSV