Transcript: Mouse NM_009544.2

Mus musculus zinc finger protein 105 (Zfp105), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zfp105 (22646)
Length:
2004
CDS:
242..1816

Additional Resources:

NCBI RefSeq record:
NM_009544.2
NBCI Gene record:
Zfp105 (22646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433296 AGTCAGCTATCTTGCCTTATT pLKO_005 1514 CDS 100% 13.200 18.480 N Zfp105 n/a
2 TRCN0000082118 CATAACCTACTGCTCCTAATA pLKO.1 1847 3UTR 100% 13.200 18.480 N Zfp105 n/a
3 TRCN0000082119 CCTAGAGTTATTGATTCCTAA pLKO.1 592 CDS 100% 4.950 6.930 N Zfp105 n/a
4 TRCN0000082122 GCAAATCTTGTTGTGCATCAA pLKO.1 935 CDS 100% 4.950 3.960 N Zfp105 n/a
5 TRCN0000418615 CAGAACCCATCTTGTTGAATA pLKO_005 1795 CDS 100% 13.200 9.240 N Zfp105 n/a
6 TRCN0000082120 GCCTTTACTCAGAGTGCAAAT pLKO.1 1340 CDS 100% 10.800 7.560 N Zfp105 n/a
7 TRCN0000082121 CCTACTCATTCATCAAAGAAT pLKO.1 1612 CDS 100% 5.625 3.938 N Zfp105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01798 pDONR223 100% 83.9% 81% None (many diffs) n/a
2 ccsbBroad304_01798 pLX_304 0% 83.9% 81% V5 (many diffs) n/a
3 TRCN0000477137 TACATTTTATAAATGTTAGCGCCC pLX_317 18.3% 83.9% 81% V5 (many diffs) n/a
Download CSV