Transcript: Mouse NM_009557.3

Mus musculus zinc finger protein 46 (Zfp46), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Zfp46 (22704)
Length:
4637
CDS:
552..1910

Additional Resources:

NCBI RefSeq record:
NM_009557.3
NBCI Gene record:
Zfp46 (22704)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304513 ACCGAGTGTGATAAGAGTTTC pLKO_005 1842 CDS 100% 10.800 15.120 N Zfp46 n/a
2 TRCN0000084583 GCGCTTATTAAACACAAGAGA pLKO.1 1875 CDS 100% 3.000 2.400 N Zfp46 n/a
3 TRCN0000304514 GATGTTTATTCACTGATTATC pLKO_005 2113 3UTR 100% 13.200 9.240 N Zfp46 n/a
4 TRCN0000304512 ATGCAGGAGAATTACGGAAAT pLKO_005 624 CDS 100% 10.800 7.560 N Zfp46 n/a
5 TRCN0000084586 GCATCCGCTACCACATTTGTT pLKO.1 898 CDS 100% 5.625 3.938 N Zfp46 n/a
6 TRCN0000084584 CAGTCAGATTTCAGACCTCAA pLKO.1 938 CDS 100% 4.050 2.835 N Zfp46 n/a
7 TRCN0000301844 CAGTCAGATTTCAGACCTCAA pLKO_005 938 CDS 100% 4.050 2.835 N Zfp46 n/a
8 TRCN0000084585 CGGGAAGAACTTCAGCCAGAA pLKO.1 1430 CDS 100% 4.050 2.835 N Zfp46 n/a
9 TRCN0000331762 CGGGAAGAACTTCAGCCAGAA pLKO_005 1430 CDS 100% 4.050 2.835 N Zfp46 n/a
10 TRCN0000084587 GCACCTCATCACGCACCAGAA pLKO.1 1622 CDS 100% 1.350 0.945 N Zfp46 n/a
11 TRCN0000434057 GAGAAGCCCTACGAGTGTAAC pLKO_005 1656 CDS 100% 10.800 5.400 Y Zfp647 n/a
12 TRCN0000226240 GAGAAGCCCTACGAGTGTAAT pLKO_005 1656 CDS 100% 13.200 6.600 Y LOC676710 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4036 3UTR 100% 4.950 2.475 Y KAAG1 n/a
14 TRCN0000178741 CACACACATACACACACACAA pLKO.1 4050 3UTR 100% 4.950 2.475 Y Cstad n/a
15 TRCN0000107752 GCACCAGAAGATCCACACCAA pLKO.1 1634 CDS 100% 2.640 1.584 N ZNF517 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09050 pDONR223 100% 79.4% 91% None (many diffs) n/a
2 ccsbBroad304_09050 pLX_304 0% 79.4% 91% V5 (many diffs) n/a
3 TRCN0000469825 CCAGTTAGTCTTTGTTTATCATAT pLX_317 35.3% 79.4% 91% V5 (many diffs) n/a
Download CSV