Transcript: Mouse NM_009722.3

Mus musculus ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 (Atp2a2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Atp2a2 (11938)
Length:
4353
CDS:
541..3537

Additional Resources:

NCBI RefSeq record:
NM_009722.3
NBCI Gene record:
Atp2a2 (11938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012432 CCTGGTGATATAGTGGAAATT pLKO.1 979 CDS 100% 13.200 18.480 N Atp2a2 n/a
2 TRCN0000321032 CCTGGTGATATAGTGGAAATT pLKO_005 979 CDS 100% 13.200 18.480 N Atp2a2 n/a
3 TRCN0000012431 CCGAGCTGTTAATCAAGACAA pLKO.1 1131 CDS 100% 4.950 3.960 N Atp2a2 n/a
4 TRCN0000321033 CCGAGCTGTTAATCAAGACAA pLKO_005 1131 CDS 100% 4.950 3.960 N Atp2a2 n/a
5 TRCN0000321034 ACGCCTGCAACTCGGTCATAA pLKO_005 1946 CDS 100% 13.200 9.240 N Atp2a2 n/a
6 TRCN0000012428 GCCTCTCTAACTGTATGATAA pLKO.1 3872 3UTR 100% 13.200 9.240 N Atp2a2 n/a
7 TRCN0000012429 GCCGTTTGTAATTCTGCTTAT pLKO.1 810 CDS 100% 10.800 7.560 N Atp2a2 n/a
8 TRCN0000321031 GCCGTTTGTAATTCTGCTTAT pLKO_005 810 CDS 100% 10.800 7.560 N Atp2a2 n/a
9 TRCN0000038471 GCCATCTACTACTTTAAGATT pLKO.1 1414 CDS 100% 5.625 3.938 N ATP2A1 n/a
10 TRCN0000038531 CCCTTGGTTGTACTTCTGTTA pLKO.1 1562 CDS 100% 4.950 3.465 N ATP2A2 n/a
11 TRCN0000310582 CCCTTGGTTGTACTTCTGTTA pLKO_005 1562 CDS 100% 4.950 3.465 N ATP2A2 n/a
12 TRCN0000012430 CCAGGATTGAAGTAGCCTCTT pLKO.1 2345 CDS 100% 4.050 2.835 N Atp2a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.