Transcript: Mouse NM_009787.2

Mus musculus protein disulfide isomerase associated 4 (Pdia4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pdia4 (12304)
Length:
2610
CDS:
209..2134

Additional Resources:

NCBI RefSeq record:
NM_009787.2
NBCI Gene record:
Pdia4 (12304)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111776 CGAGAGAAATATGGGATTGTT pLKO.1 1004 CDS 100% 5.625 7.875 N Pdia4 n/a
2 TRCN0000111778 GCCAGTACTTTGAAGGATAAT pLKO.1 509 CDS 100% 13.200 9.240 N Pdia4 n/a
3 TRCN0000316230 GCCAGTACTTTGAAGGATAAT pLKO_005 509 CDS 100% 13.200 9.240 N Pdia4 n/a
4 TRCN0000111779 GCTAACAACCTGAGAGAAGAT pLKO.1 1175 CDS 100% 4.950 3.465 N Pdia4 n/a
5 TRCN0000316228 GCTAACAACCTGAGAGAAGAT pLKO_005 1175 CDS 100% 4.950 3.465 N Pdia4 n/a
6 TRCN0000111777 CCCACGAGAGAAATATGGGAT pLKO.1 1000 CDS 100% 2.640 1.848 N Pdia4 n/a
7 TRCN0000316302 CCCACGAGAGAAATATGGGAT pLKO_005 1000 CDS 100% 2.640 1.848 N Pdia4 n/a
8 TRCN0000111775 CCACACTTTCAGCCCTGAAAT pLKO.1 1207 CDS 100% 1.320 0.924 N Pdia4 n/a
9 TRCN0000316227 CCACACTTTCAGCCCTGAAAT pLKO_005 1207 CDS 100% 1.320 0.924 N Pdia4 n/a
10 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 333 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02208 pDONR223 100% 86.3% 88.5% None (many diffs) n/a
2 ccsbBroad304_02208 pLX_304 0% 86.3% 88.5% V5 (many diffs) n/a
3 TRCN0000466550 TCCGAAGTCGGTAGATTGACGGCG pLX_317 15.7% 86.3% 88.5% V5 (many diffs) n/a
Download CSV