Transcript: Mouse NM_009834.2

Mus musculus nocturnin (Noct), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Noct (12457)
Length:
3069
CDS:
658..1947

Additional Resources:

NCBI RefSeq record:
NM_009834.2
NBCI Gene record:
Noct (12457)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099679 GAACACAACAACGGTCCAGAT pLKO.1 1333 CDS 100% 4.050 5.670 N Noct n/a
2 TRCN0000099676 GCTTATCAGCAGCACCAATAT pLKO.1 1389 CDS 100% 13.200 9.240 N Noct n/a
3 TRCN0000099677 CCAACCGAAGAGGTCTACAAA pLKO.1 1636 CDS 100% 5.625 3.938 N Noct n/a
4 TRCN0000099678 GAAGAGGTCTACAAACACTTT pLKO.1 1642 CDS 100% 4.950 3.465 N Noct n/a
5 TRCN0000099675 GCACTCCAGTTTGAGCTTGTT pLKO.1 2115 3UTR 100% 4.950 3.465 N Noct n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009834.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02862 pDONR223 100% 84.6% 90.2% None (many diffs) n/a
2 ccsbBroad304_02862 pLX_304 0% 84.6% 90.2% V5 (many diffs) n/a
3 TRCN0000479099 ATCTGCCGAGGGCGAGATCCTCTT pLX_317 38.5% 84.6% 90.2% V5 (many diffs) n/a
Download CSV