Transcript: Mouse NM_009925.4

Mus musculus collagen, type X, alpha 1 (Col10a1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Col10a1 (12813)
Length:
3139
CDS:
79..2121

Additional Resources:

NCBI RefSeq record:
NM_009925.4
NBCI Gene record:
Col10a1 (12813)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009925.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092006 CCTACGATGTACACGTATGAT pLKO.1 1936 CDS 100% 5.625 7.875 N Col10a1 n/a
2 TRCN0000092007 GACACAATACTTCATCCCATA pLKO.1 195 CDS 100% 4.050 3.240 N Col10a1 n/a
3 TRCN0000092005 CGACCCAAGATCTGGTATCTT pLKO.1 1824 CDS 100% 0.563 0.450 N Col10a1 n/a
4 TRCN0000092004 CGCCATAAAGAGTAAAGGGAT pLKO.1 216 CDS 100% 2.640 1.848 N Col10a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009925.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00343 pDONR223 100% 85.7% 87.3% None (many diffs) n/a
2 ccsbBroad304_00343 pLX_304 0% 85.7% 87.3% V5 (many diffs) n/a
3 TRCN0000477340 GACGGATTCTGTAATGGCCCATTT pLX_317 22.1% 85.7% 87.3% V5 (many diffs) n/a
Download CSV