Transcript: Mouse NM_009945.3

Mus musculus cytochrome c oxidase subunit VIIa 2 (Cox7a2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cox7a2 (12866)
Length:
754
CDS:
197..448

Additional Resources:

NCBI RefSeq record:
NM_009945.3
NBCI Gene record:
Cox7a2 (12866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076485 CTGTTAGCTATGGCTGCATTT pLKO.1 410 CDS 100% 10.800 7.560 N Cox7a2 n/a
2 TRCN0000076487 ATTTCCCAAGAAGCAGAACTA pLKO.1 427 CDS 100% 4.950 3.465 N Cox7a2 n/a
3 TRCN0000326625 ATTTCCCAAGAAGCAGAACTA pLKO_005 427 CDS 100% 4.950 3.465 N Cox7a2 n/a
4 TRCN0000076483 CACGTGGTTCAGTTTCATCAA pLKO.1 467 3UTR 100% 4.950 3.465 N Cox7a2 n/a
5 TRCN0000354189 CACGTGGTTCAGTTTCATCAA pLKO_005 467 3UTR 100% 4.950 3.465 N Cox7a2 n/a
6 TRCN0000076486 GAGGATAATGGGATGCCAGTT pLKO.1 305 CDS 100% 4.050 2.835 N Cox7a2 n/a
7 TRCN0000326626 GAGGATAATGGGATGCCAGTT pLKO_005 305 CDS 100% 4.050 2.835 N Cox7a2 n/a
8 TRCN0000076484 GCACCACTTCACGAAGGCATT pLKO.1 246 CDS 100% 4.050 2.835 N Cox7a2 n/a
9 TRCN0000354190 GCACCACTTCACGAAGGCATT pLKO_005 246 CDS 100% 4.050 2.835 N Cox7a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.