Transcript: Mouse NM_010075.2

Mus musculus dipeptidylpeptidase 6 (Dpp6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dpp6 (13483)
Length:
4866
CDS:
703..3117

Additional Resources:

NCBI RefSeq record:
NM_010075.2
NBCI Gene record:
Dpp6 (13483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031427 CCTATAATGTGGAGCCGGTAT pLKO.1 1130 CDS 100% 4.050 5.670 N Dpp6 n/a
2 TRCN0000031425 GCGGAATGTTGAAACAAATAA pLKO.1 1020 CDS 100% 15.000 10.500 N Dpp6 n/a
3 TRCN0000031426 CGCTTCTTTCAGCCATAACAT pLKO.1 2139 CDS 100% 5.625 3.938 N Dpp6 n/a
4 TRCN0000031428 CTCCATGTCATCGGCTTGAAT pLKO.1 1585 CDS 100% 5.625 3.938 N Dpp6 n/a
5 TRCN0000031424 CCCAGATGAGAGTCACTACTT pLKO.1 2976 CDS 100% 4.950 3.465 N Dpp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06117 pDONR223 100% 84.2% 90.3% None (many diffs) n/a
2 TRCN0000475895 TGACCAGGCTTGGCCAATGACTTC pLX_317 14.3% 84.2% 90.3% V5 (many diffs) n/a
3 ccsbBroadEn_14618 pDONR223 50.6% 84% 90.3% None (many diffs) n/a
Download CSV